adan131 adan131
  • 03-11-2018
  • English
contestada

This year we are growing corn. (Irregular past tense)

Respuesta :

elianarenee6 elianarenee6
  • 03-11-2018
The past year have been growing corn.
Answer Link

Otras preguntas

Desarrolla las configuraciones electrónicas tanto simple como vectorial de los elementos mostrados en la tabla e indica sus electrones de valencia, aplicando Re
Example: Yo como chocolate. (comer - to eat)Ellatamales. (cocinar - to cook)Élen México. (vivir - to live)Nosotroslas pizzas. (cortar - to cut)¿tú salsa picante
A car of 1400 kg is subject to multiple forces which produce an acceleration of 3.5 m/s2 directed north. Find the net force.​
Which of the following best describes compounds
que podemos decir sobre el efecto que tiene el azúcar en la ebullición del agua?​
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
How many chromosomes do daughter cells have after mitosis? A. none B. twice as many as the parent cell C. half as many as the parent cell D. the same number as
Someone plz help me :(
Which is the correct statement
How might vernacular literature help with the growing sense of national identity in certain countries? * Vernacular literature celebrated the native language, r