ilovewaffles70 ilovewaffles70
  • 01-03-2019
  • Mathematics
contestada

I need answers quick!!!

I need answers quick class=

Respuesta :

frommywindow1
frommywindow1 frommywindow1
  • 01-03-2019

Answer:

60

Step-by-step explanation:

Answer Link

Otras preguntas

But fate, that night, intended Grendel to gnaw the broken bones Of his last human supper" (9) shows which literary term? A. kenning B. foreshadowing C. allitera
Question 7 write a rule to describe each transformation
What does tabula rasa refer to? A. a medieval writing tablet B. the notion that humans are born with built-in mental content C. the notion that humans are not b
True or false: The question "Should everyone buy a car with a hybrid engine?" can be answered using a scientific approach.
How to solve 180-(2y-10)
The volume of a rectangular prism is given by the expression10x3 46x2 – 21x – 27. The area of the base of the prism is given by the expression 2x2 8x – 9. Which
Raul and Athena make bumper stickers. They know that their fixed costs are $145 and the cost of each bumper sticker is $2. Write an equation for the total cost
I need help with this ASAP.. I have to get it done tonight can someone please help me
find the equation of each circle center (5, 1/4) radius 6
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'