Shawnaboo12397 Shawnaboo12397
  • 02-11-2019
  • Mathematics
contestada

A farmers land is separated into sections of size 2 1/4 acres suppose there are 14 such sections . How many acres of the land does the farmer own?

Respuesta :

Аноним Аноним
  • 02-11-2019

Answer: 31 1/2 acres

Step-by-step explanation:

2 1/4 = 2.25

2.25 * 14 = 31.5

31.5 = 31 2/4

31 2/4 = 31 1/2

Answer Link

Otras preguntas

Which process is a form of autotrophic nutrition? A) transport B) regulation C)fermentation D) photosynthesis
Why the volteg in the limp lead is differant from the chest lead
What is the only evidence we can get from a star?
if someone is colorblind which structure is malfunctioning
What were citizens upset about in the Yazoo Land Fraud?
Explain how the resolution of Proctor's conflict reveals a major theme in the play.
how do you answer this 99-2*2+1
Convert 114five 1 to base ten.
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
How many chromosomes do daughter cells have after mitosis? A. none B. twice as many as the parent cell C. half as many as the parent cell D. the same number as