gurungs7430 gurungs7430

04-06-2020
SAT

contestada

F(x)=ax+2 In the Function above? a is a constant. If F( -1 )=4, what is the value of F(-1/2)?

Respuesta :

aquaamann333 aquaamann333

04-06-2020

Answer:

3

Explanation:

Answer Link

Otras preguntas

Researchers are exploring whether treatment with ________ might improve social behavior in those with asd.

What type of stock receives an equal part of the profits on each share to be distributed after all other obligations of a company have been satisfied? A.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

At a fast food restaurant, four friends each ordered a sandwich for $4.89 each and a drink for $1.69. What is the best estimate of the amount of change they wil

SECTION 1 OF 1 1234567891011121314 Consider the following three statements: As children grow older, their weight increases. As children grow older, they expand

Which country is the world’s largest producer of wheat? USA China Russia France

circadian rhythm refers to

Which of the following explains why an actual cost might differ from a projected cost? -The desired item goes on sale. -The item is no longer available and a re

Write a scientific explanation to describe the impact of the infected papaya trees on the toucan population.

How is the creation of public policy in Russia different from that in the United States?