Seudónimo Seudónimo
  • 04-06-2020
  • Geography
contestada

NEED HELP ASAP!!
What is the typical climate of Lota, Chile???

Respuesta :

laffeyettes
laffeyettes laffeyettes
  • 04-06-2020

Answer:

the temps are usually from the hi 50's to hi 60's

Answer Link

Otras preguntas

help!!! show the solution set for the following system of inequalities
The Mayan developed a language, system of numbers, and a calendar. True False
people go with my mett code yhv-ehoo-tji
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
the lower atmosphere and hydrosphere are bound to earth by
Why is learning about your identity important? What have you learned about yourself during this identity unit? What have you learned about someone else?
No irrational numbers are whole numbers. True or false? Explain your answer
1. In evaluating a narrative, we based on a. setting, characters, and plot c. setting , characters , plot, theme and point of view b. Plot, theme and point of v
What is the potential energy of the car at the beginning of the experiment before it's speed is measured
1. A baseball pitcher has pitched 12 2/3 innings.