mariamibaramadze mariamibaramadze

02-10-2020
Mathematics

contestada

pls help I need to find X but I’m confused idk geometry

pls help I need to find X but Im confused idk geometry class=

Respuesta :

02-10-2020

Answer:

x = 147 they have to be equal

Answer Link

Otras preguntas

Who basically "began" England's religious reformation?

Triangle ABC has side lengths: AB = 3.5 cm, BC = 2.4 cm, and AC = 4.2 cm ΔABC ≅ ΔHJK What is the length of side HJ? HJ = ______cm

Berlin laughs uncontrollably in where have you gone charming billy because he finds billys death

Why did new technology revolutionize communications

how is mechanical weathering best described A. The buildup of chemical deposits on the surface B. The breakdown of rock through mechanical disintegration and ph

3m2+7=55 answer please

Brainliest, what is the total measure of angles 8 and 5 of angle 7 equals 61

The actions of the pueblo indians at santa fe in 1680 can best be described as:

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

If you dissolve 14.2 grams of licl in enough water to make 0.450 l of solutions, what is the molarity of the solution?