otfgucci73 otfgucci73

04-02-2021
Mathematics

contestada

what is n??????????????????????????????????????/

what is n class=

Respuesta :

jadehralston jadehralston

04-02-2021

Answer:

n = 38

Step-by-step explanation:

3n - 15 + 2n + 5 = 180

5n - 10 = 180

5n = 190

n = 38

Answer Link

Otras preguntas

Tyra makes $21.40 per hour at her job for the first 40 hours and $32.10 for anything over 40 hours. if tyra typically works 45 hours per week, how much does she

how is the graph of y=9(3)^x+2 +6 translated from the graph of y+9(3)^x

Find f(x) if it is known that f(x−2)=2x−4.

Why is plagiarism a violation of ethics? a. it makes psychology researchers look bad. b. it violates an apa standard. c. it is akin to lying. d. it violates a b

If your company has a large production-related task, such as assembling an airplane, what strategy could help you increase productivity?

What was the extent of islamic expansion one century after muhammad's death?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

El clima de la costa Guatemalteca es tropical, es decir es ______________________.

difference between syntax and semantics

if 2^x-4=4a^x-6 what is the value of a