princessnie12
princessnie12 princessnie12
  • 03-06-2021
  • Mathematics
contestada

I need help if anyone knows the answer please ASAP

I need help if anyone knows the answer please ASAP class=

Respuesta :

YCCMAnon
YCCMAnon YCCMAnon
  • 03-06-2021

Answer:

TE=11

Step-by-step explanation:

[tex]x^2+6x=x+14\\x^2+6x-x-14=0\\x^2+5x-14=0\\(x-2)(x+7)=0\\x=2\\x=-7\\[/tex]

(you can't use -7 cuz that would make TE a negative distance and that's a nono)

[tex]x=2\\TE=6(2)-1\\=12-1\\=11[/tex]

Answer Link

Otras preguntas

Simplify the expression: (5a^4b^2)^3(-2b^4)
A 2000 calorie diet in which carbohydrate provides 50% of the calories would provide how many grams of carbohydrate?
One number is 6 more than twice the other number. if the sum of the two numbers is 36​, find the two numbers.
Which order pair could be removed so that the set of ordered pairs is a function (4,-2) (-3,2) (3,4) (1,1)
What was the main idea of Rousseau's famous work "The Social Contract".
How many natural numbers less than 300 are either multiples of 2 or multiples of 3?
Proof: it is given that angle 1 and angle 2 are supplementary. angle 1 and angle 3 are also supplementary, so angle 2 is equal or equivalent to angle 3. since _
Attorney general a. mitchell palmer believed that he needed to protect the american people from
The right to a trial by jury in a criminal case is outlined in which amendment?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat