nessab nessab
  • 03-06-2021
  • Mathematics
contestada

WILL GIVE BRAINLIEST find the value of x

WILL GIVE BRAINLIEST find the value of x class=

Respuesta :

lifemail lifemail
  • 03-06-2021

Answer:

143.5

Step-by-step explanation:

Answer Link
luvvaliciia
luvvaliciia luvvaliciia
  • 03-06-2021
143.5...............
Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
A relation is A. the output (y) values of the relation B. the input (x) values of the relation C. a set of points that pair input values with output values D. x
What is the solution to the following equation? 5(2x − 14) + 23 = 7x − 14 11 14 30 36
List and briefly describe each of the five strength training principles. (Site 1)
BC is parallel to DE What is AC? Enter your answer in the box.
Satellite can focus on specific latitudes using?
With increasing doses of any useful drug there is usually an increase in the number and severity of
1. Read the paragraph below. When Tyrese dropped his crutches and limped to the starting block, the audience froze. Then the starter’s signal sounded, and the s
PLEASE HELP!!!! NEED HELP!!!! An automotive insurance company has 25,000 policyholders. The accident rate is 0.07. The number of accidents the company will hav
The sum of two numbers is 69. The larger number is three less than twice the smaller number. Find the numbers. Show your work.