shafferwaniiah shafferwaniiah
  • 01-03-2022
  • Social Studies
contestada

Which resource provides Ghana's main source of electricity? A oil field
B solar panel
C river dam
D wind farm​

Respuesta :

thenewreaper29 thenewreaper29
  • 08-03-2022

The Answer is C

Explanation:

River dams are used for electricity.

Answer Link

Otras preguntas

why did Mr Collins come to the Bennet family looking for a wife?
Which additional word in the poem should be capitalized? Coyote In the night, it prowls alone hidden from view, Stalking prey. Before dawn, Coyote howls.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
when Jefferson took office he did what
how can you write 0.45 as fraction and a percentage ,please show work
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
what is the percent change from 70 to 56?
Explain who or what "Año Viejo" is and its significance.
as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash